First molecular identification and characterization of Spiroplasma citri, the causal agent of citrus stubborn disease in Algerian citrus groves

Citrus is one of the most popular fruit crops cultivated in Algeria. The major citrus production regions is situated in the Mitidja area in the Northern part of the country. In order to assess the presence of Spiroplasma citri, the causal agent of citrus stubborn disease, a field survey was carried out during the summer on two citrus varietal collections located in the Mitidja, the main citrus growing area. Among the 112 collected samples, two infected trees were identified by molecular techniques in both varietal collections using specific primers SC1-fw (5'ATTTTCAATTTGATGTTTATCAAGACAAC3') and SC1-rev (5'CAAAATCACTTGC TCCTGCATTTGG3') (Saillard C., not published). The partial Spiralin gene nucleotide sequence retrieved from the Algerian isolate (GenBank accession No. LN713947.1), revealed a high percentage of nucleotide homology (99%) with the Iranian Fasa I strain isolated from a leafhopper vector (FJ755921.1) (Khanchezar et al. 2014). Interestingly, the Algerian isolate also reacted positively with the primer pairs targeting the TraG gene (Breton et al. 2010) which is essential for insect transmission and predicts a natural diffusion of the pathogen in case of the presence of insect vectors Circulifer haematoceps in the infected area. The obtained sequence (LN908966) revealed 97% nucleotide homology with Spiroplasma citri plasmid pSci6 from the Moroccan strain GII3. S. citri was previously reported in Algeria by Vignault et al. (1980) by isolation from plant material showing symptoms of the disease but no other investigations were carried out afterwards. To our knowledge, this is the first molecular identification and characterization of S. citri in the country.