Bell pepper endornavirus (BPEV) has a single linear single-stranded RNA genome and belongs to the genus Alphaendornavirus, family Endornaviridae. This virus has been reported in cultivated peppers (Capsicum spp.) worldwide and most recently in north Africa (Nahdi et al., 2023). In this context, total RNA was isolated from greenhouse-cultivated sweet pepper plants showing virus-like symptoms in the coastal regions of Syria (Tartous) and Lebanon (Byblos) and tested for viruses by RT-PCR. Incidence of symptomatic plants ranged from 8 to 15% in both locations. Results revealed the presence of tomato brown rugose fruit virus, as previously reported (Abou Kubaa et al. 2022). Subsequent RT-PCR screening with specific primers dBPEV-12,632 F/ dBPEV-13238R (Tomašechová et al. 2020) revealed also the presence of BPEV. This virus was found in 12 symptomatic samples and three asymptomatic samples. To confirm the presence of BPEV, a new primer pair (BPEV_13526F: GCGCAAAACAAGCTGACTTACA and. BPEV_13996R: ATCGTCATGCACCCCTAACA) was designed in the BPEV-encoded RNA-dependent RNA polymerase gene to amplify a 471 bp fragment in RT-PCR. DNA amplicons of the expected size were obtained from the 15 positive samples. To verify the nature of the DNA products, one representative RT-PCR amplicon from a Syrian sample and from a Lebanese sample was directly sequenced in both directions. BLASTn analyses showed 99.6% identify between the Syrian and the Lebanese BEPV isolates, and up to 100% nucleotide sequence identity with other isolates for which information is available in GenBank. Sequences determined in this study were deposited in GenBank as accession numbers OQ657983 (isolate SYR.08 from Syria) and OQ657984 (isolate LEB.15 from Lebanon). This is the first report of BEPV in pepper plants in the Middle East.

First report of bell pepper endornavirus in pepper in Syria and Lebanon

Abou Kubaa, Raied;Saponari, Maria;
2024

Abstract

Bell pepper endornavirus (BPEV) has a single linear single-stranded RNA genome and belongs to the genus Alphaendornavirus, family Endornaviridae. This virus has been reported in cultivated peppers (Capsicum spp.) worldwide and most recently in north Africa (Nahdi et al., 2023). In this context, total RNA was isolated from greenhouse-cultivated sweet pepper plants showing virus-like symptoms in the coastal regions of Syria (Tartous) and Lebanon (Byblos) and tested for viruses by RT-PCR. Incidence of symptomatic plants ranged from 8 to 15% in both locations. Results revealed the presence of tomato brown rugose fruit virus, as previously reported (Abou Kubaa et al. 2022). Subsequent RT-PCR screening with specific primers dBPEV-12,632 F/ dBPEV-13238R (Tomašechová et al. 2020) revealed also the presence of BPEV. This virus was found in 12 symptomatic samples and three asymptomatic samples. To confirm the presence of BPEV, a new primer pair (BPEV_13526F: GCGCAAAACAAGCTGACTTACA and. BPEV_13996R: ATCGTCATGCACCCCTAACA) was designed in the BPEV-encoded RNA-dependent RNA polymerase gene to amplify a 471 bp fragment in RT-PCR. DNA amplicons of the expected size were obtained from the 15 positive samples. To verify the nature of the DNA products, one representative RT-PCR amplicon from a Syrian sample and from a Lebanese sample was directly sequenced in both directions. BLASTn analyses showed 99.6% identify between the Syrian and the Lebanese BEPV isolates, and up to 100% nucleotide sequence identity with other isolates for which information is available in GenBank. Sequences determined in this study were deposited in GenBank as accession numbers OQ657983 (isolate SYR.08 from Syria) and OQ657984 (isolate LEB.15 from Lebanon). This is the first report of BEPV in pepper plants in the Middle East.
2024
Istituto per la Protezione Sostenibile delle Piante - IPSP - Sede Secondaria Bari
BEPV
Capsicum spp
Lebanon
Pepper
Syria
File in questo prodotto:
File Dimensione Formato  
Abou Kubaa et al 2024.pdf

accesso aperto

Descrizione: Abou Kubaa et al., 2024
Tipologia: Versione Editoriale (PDF)
Licenza: Creative commons
Dimensione 499.98 kB
Formato Adobe PDF
499.98 kB Adobe PDF Visualizza/Apri

I documenti in IRIS sono protetti da copyright e tutti i diritti sono riservati, salvo diversa indicazione.

Utilizza questo identificativo per citare o creare un link a questo documento: https://hdl.handle.net/20.500.14243/516489
Citazioni
  • ???jsp.display-item.citation.pmc??? ND
  • Scopus 1
  • ???jsp.display-item.citation.isi??? 1
social impact