In Tunisia, tomato is the most important vegetable crop which, due to the favourable climatic conditions, is grown the whole year round. During field surveys conducted in autumn 2012, symptoms of severe yellowing, brittleness and thickening of mature leaves were observed in late tomato crops. Yellowing symptoms on older leaves were also observed in the main Tunisian artichoke-growing areas. Samples collected from symptomatic and symptomless tomato and artichoke plants from Kairouan and Bizerte, Ariana and Mannouba regions, respectively, were screened preliminary with Dig-labelled DNA probes for viruses infecting tomato and artichoke (Minutillo et al., 2012). In some samples a hybridization signal suggested the presence of Tomato infectious chlorosis virus (TICV). Total RNA was extracted from fresh leaf tissues according to CTAB protocol, reverse transcribed and subjected to PCR using the TICV-specific primer pair FOR-TCAGTGCGTACGTTAATGGG and REV- CACAGTATACAGCAGCGGCAG (Minutillo et al., 2012). A product of about 500 bp was amplified from 6 of 20 tomato and from 8 of 161 artichoke sample tested. The nucleotide sequence of two amplicons from tomato and one from artichoke was obtained and deposited in GenBank under accession Nos. KF873014, KF873015 and KF873016. The nucleotide sequence of Tunisian isolates was 98.7 to 100% identical and shared more than 99% identity with that of a TICV isolate from USA (accession No. FJ 542306). To the best of our knowledge, this is the first report of TICV on tomato and artichoke in Tunisia. Although we found the virus on two species in three different regions, its distribution is likely to be wider, since the symptoms cannot be unambiguously distinguished from those of mineral deficiency or physiological disorders.

First report of Tomato infectious chlorosis virus in Tunisia

Spano R.;Gallitelli D.
2014

Abstract

In Tunisia, tomato is the most important vegetable crop which, due to the favourable climatic conditions, is grown the whole year round. During field surveys conducted in autumn 2012, symptoms of severe yellowing, brittleness and thickening of mature leaves were observed in late tomato crops. Yellowing symptoms on older leaves were also observed in the main Tunisian artichoke-growing areas. Samples collected from symptomatic and symptomless tomato and artichoke plants from Kairouan and Bizerte, Ariana and Mannouba regions, respectively, were screened preliminary with Dig-labelled DNA probes for viruses infecting tomato and artichoke (Minutillo et al., 2012). In some samples a hybridization signal suggested the presence of Tomato infectious chlorosis virus (TICV). Total RNA was extracted from fresh leaf tissues according to CTAB protocol, reverse transcribed and subjected to PCR using the TICV-specific primer pair FOR-TCAGTGCGTACGTTAATGGG and REV- CACAGTATACAGCAGCGGCAG (Minutillo et al., 2012). A product of about 500 bp was amplified from 6 of 20 tomato and from 8 of 161 artichoke sample tested. The nucleotide sequence of two amplicons from tomato and one from artichoke was obtained and deposited in GenBank under accession Nos. KF873014, KF873015 and KF873016. The nucleotide sequence of Tunisian isolates was 98.7 to 100% identical and shared more than 99% identity with that of a TICV isolate from USA (accession No. FJ 542306). To the best of our knowledge, this is the first report of TICV on tomato and artichoke in Tunisia. Although we found the virus on two species in three different regions, its distribution is likely to be wider, since the symptoms cannot be unambiguously distinguished from those of mineral deficiency or physiological disorders.
2014
Istituto per la Protezione Sostenibile delle Piante - IPSP - Sede Secondaria Bari
TOMATO INFECTIOUS CHLOROSIS VIRUS
File in questo prodotto:
File Dimensione Formato  
Salleh W. Mnari-Hattab M. Minutillo S.A. Spanò R. Zammouri S. and Gallitelli D. 2014. JPP 96 2.433.pdf

solo utenti autorizzati

Descrizione: First report of Tomato infectious chlorosis virus in Tunisia.
Tipologia: Versione Editoriale (PDF)
Licenza: NON PUBBLICO - Accesso privato/ristretto
Dimensione 56.11 kB
Formato Adobe PDF
56.11 kB Adobe PDF   Visualizza/Apri   Richiedi una copia

I documenti in IRIS sono protetti da copyright e tutti i diritti sono riservati, salvo diversa indicazione.

Utilizza questo identificativo per citare o creare un link a questo documento: https://hdl.handle.net/20.500.14243/518711
Citazioni
  • ???jsp.display-item.citation.pmc??? ND
  • Scopus 2
  • ???jsp.display-item.citation.isi??? 0
social impact